Categorias

Relatos Eróticos

Lo más buscado

Ultimas fotos

Photo
Enviada por galigul

Photo
Enviada por galigul

Photo
Enviada por galigul


COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA:

Click to this video!
comando bigos Relato enviado por : comando bigos el 19/04/2014. Lecturas: 5117

etiquetas relato COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA: Fantasias .
Descargar en pdf Descarga el relato en pdf
Resumen
esa noche estaba sola y decidi pasar a tomarme una cerveza con la idea de encontrarme al chaparro que emos fantasiado mi esposo y yo y termino en una gran cogida con el chaparro que si tiene una tremenda vergota y mas.....


Relato
COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA: Hola su amiga rosario con otro relato de una aventura que realice con conocimiento de mi esposo y así fue tiene ya tiempo que en la cervecería que vamos a tomar hay un chavito chaparrito que desde que lo vi me llamo la atención y se lo comente a mi esposo raul y empezaron a salir comentarios cachondos como el que dicen que los chaparros están bien vergudos y que si me gustaría cogérmelo y la verdad no me he decidido pero la verdad si me lo quiero coger total que mi esposo se enfermo y lo interne en el hospital operándolo del apéndice y el viernes que fui a la visita me fui bien arreglada con un vestido negro con manchitas blancas que me queda bien pegado al cuerpo y arriba de media pierna raul al verme me dice guau que rica te vez a dónde vas a ir a ningún lado le dije pero eso me inquieto y me acorde del chaparrito de la cervecería pero no le comente nada me quede más tarde con él y Salí del hospital ya casi a las 10:00 de la noche y venia inquieta de pasar a tomarme una cerveza y decidida a que si me encontraba al chavo provocarlo para que me cogiera total que me venía dando unos jalones de coca y me puse mas cachonda y eso me motivo para ir a la cervecería llegue y al estarme estacionando vi que salió el chavito volteando hacia mí y al notar que iba sola y ver que me iba a bajar se acerco rápido hacia la camioneta de lado y me dice hola a poco viene sola si tú crees y no le da miedo de que se la roben lo mire a los ojos y sonriendo le dije ojala que deberás haya un atrevido y me robe por unas horas y reímos los dos abrí la puerta y se acerco para ayudarme a bajar me dio la mano y su mirada se clavo en mis piernas yo a propósito las abrí dejándolo ver mi panochita ya que no traía tanga baje y empezamos a caminar entre y me dice si gusta yo le llevo su cerveza acepte y regrese a la camioneta me subí mas el vestido para ponerlo cachondo y lo logre al llegar abrí la puerta para recibírsela y me gire hacia el dejándole ver otra vez todo me dice le sirvo por favor yo movía las piernas abriéndolas y cerrándolas y él como hipnotizado no dejaba de verme me dio el vaso y la cerveza y se retiro diciéndome aquí voy a estar para lo que se le ofrezca gracias en un rato regreso por si quiere que le sirva mas cerveza y se fue yo empecé a tomar la cerveza y me di otros jalones ricos y vi que no me vieran y me eche en mi panochita bastante con los dedos aproveche para darme una dedeada rica sacándome varios gemidos de placer aaaahhhhhh que rico siento mmmmmm me encanta lo que siento pasaron unos minutos y regreso parándose del lado del copiloto se asoma y me dice que si no me hacía falta nada baje el vidrio y le pedí que me sirviera mas cerveza le di el vaso y la cerveza le dije si quieres abre la puerta para que no la vayas a tirar lo hizo y se quedo parado me gire hacia él y seguía mirando mis piernas y mi panochita ya que al echarme la coca me subí el vestido y así me lo había dejado y le digo por cierto me trajiste cerveza clara y a mí me gusta más la negra esta mas rica deberás le gusta más la negra es más fuerte verdad y le digo estamos hablando de la cerveza y sonreí se retiro y sentí que estaba logrando mi objetivo al poco rato regreso y traía una cerveza y me dice aquí le traigo la negra y yo riendo le digo en donde dirigiendo mi mirada hacia su entrepierna le sirvo se puso más nervioso pero me di cuenta que ya tenía parada la verga le di mi vaso y me sirvió al dármelo le dije quieres tomarte un vaso conmigo claro seria un placer voy por un vaso pensé ya cayo me acomode con las piernas entre los dos asientos y me volví a subir el vestido casi dejando ver mi panochita regreso y le dije que se subiera lo hizo y se sirvió me dice salud por el honor de dejarme convivir con usted trataba de disimular que no dejaba de mirarme las piernas y más le pregunto y a propósito cómo te llamas miguel señora a sus órdenes para lo que se le ofrezca le tome a mi vaso y sonriendo le digo deberás para lo que se me ofrezca claro señora usted nada mas ordene baje la mirada hacia su entre pierna y le dije te soy atractiva claro señora esta súper hermosa y con un cuerpazo nada mas de verla me pone inquieto se atrevió y metió su mano hasta mi panochita solté un gemido aaaaahhhhhhiiiii perdón señora y quiso retirar la mano se la detuve y le dije no la quites síguele y empezó a cachondearme rico y metió un dedo en mi panochita aaaassssiiii que rico mételo siento rico aaaahhhhhh yo le agarre la verga y se la saque del pantalón y al verla me impresiono ggggguuuuuuuaaaaauuuuu que vergota tienes esta enorme le gusta señora si esta preciosa la tenía en mi mano y no alcanzaba a rodearla toda parecía de burro de lo gorda y Larga que la tenia calcule que fácil media 24cm.y me acorde del comentario que hicimos mi esposo y yo de que los chaparros son vergudos y al menos este si estaba vergudo lo mire a los ojos y le dije te gustaría que te la mame deberás lo haría claro se me antojo pues por mi encantado y me agache sin importarme que me vieran y se la empecé a chupar mmmmmm que rica vergota tienes miguel le gusto señora claro esta divina y me la metía poco a poco más en la boca hasta que logre tragármela toda que rico señora lo chupa súper sabroso te gusta como lo hago claro lo hace delicioso cómasela toda aaaahhhhhh la tenia agarrada con las dos manos y me la metía hasta adentro de mi garganta que verga tan deliciosa mmmmmm sentí una de sus manos en mi cabeza y me la empujaba hacia su vergota provocando que me la tragara toda así señora aaaassssiiii ya me va hacer venir me detuve y le dije quieres ver que me trague tus mocos claro se ha de sentir rico y soltó el primer chorro y otro y varios más llenándome la boca de mocos y me los empecé a tragar mmmmmm aaaassssiiii que rico échamelos todosssssss hhhhaaaaayyyy que delicia me encantan los mocos y de un chavito saben más ricos vente rico mmmmmm le chupeteaba la cabezota sacándole todos me levante y le dije te gusto si se siente rico gracias señora quieres metérmela seria un placer me deja claro quiero sentir este moustro en mi panochita le dije que nos pasáramos al asiento de atrás y lo hicimos ya atrás me enrolle el vestido en la cintura y me monte en sus piernas ensartándome su vergota aaaaahhhhhhiiiii que rico que gran verga tienes miguel yyyyyyaaaaaa la quiero toda adentro y me di un sentón tragándomela toda así aaaassssiiii que sabroso siento la tengo toda adentro aaaahhhhhh cógeme rico dame duro y me daba cada vez mas fuerte los sentones tragándomela toda y al levantarme dejaba adentro nada mas la cabezota y me la volvía a meter toda que vergaaaaa tan rica empecé a mover mis nalgas para todos lados y en círculos el bramaba de placer que rico señora que gran mujer es usted coge como reina aaaahhhhhh siga moviéndose así siento delicioso que suerte tiene su esposo de tenerla tan hermosa y buenísima para coger si te gusta cómo te lo hago no me gusta me fascina nunca me imagine que se pudiera fijar en mi señora gracias cógeme mas así la tengo hasta el fondo me encanta comerme vergas como la tuya pues cuando gusto yo estoy a su disposición nada ordéneme y yo estoy a sus pies oírlo decirme eso me ponía más caliente de pronto me dice yyyyyyaaaaaa me quiero venir si vente lléname mi panochita de leche échamelos aaaassssiiii aaaaaaagggggghhhhhhh que rico me estoy viniendo junto contigo siénteme aaaaaahhhhhhh que ricoooooo rrrrriiiiiiccccooooo me saco varios orgasmos y me lleno la panochita de mocos terminamos y me zafe le digo que bárbaro me echaste muchísimos que vigor tienes que edad tienes 17años señora estas bien chavo pero que vergota te dio dios me saque sus mocos con la mano de mi panochita y me los comí lo jale para besarlo y le digo bésame para que pruebes tus mocos revueltos con los míos y le pase parte de su leche te gusto si saben ricos me saque mas y se los puse en la boca comételos y lo hizo se me pare y vi que seguía con la vergotaaaaa bien tiesa se la acaricie y le digo quieres mas pues si me deja por mi encantado lo mire a los ojos y le digo te voy a dejar que me cojas por mi culito nada más porque esta verga se lo merece ni a mi esposo casi lo dejo que me la meta por ahí pero esta verga vale la pena tenerla adentro me levante y me acomodo de rodillas en el sillón y me empine parándole rico mi culito volteé a verlo y le digo te gusta si se te antoja claro que hermoso culo tiene señora divino pues ven méteme esa vergota se acomodo y me dio primero unas chupadas que rico culo tiene señora mmmmmm metía la punta de su lengua en mi hoyito así que rico me echo saliva y metió un dedo como para aflojarme y entrara su vergota se levanto y me apunto la cabezota en la entrada y empezó a empujarla despacio que enorme esta sentí como entro la cabezota aaaaaahhhhhhiiiiiiii que rico ya entro la cabezota que rico y seguía empujándomela despacio que sabrosa verga sentí que ya me había metido casi la mitad y empuje mis nalgas hacia él y me la trague toda aaaaaahhhhhhhhh que rico ya la tengo toda adentro que rico cógeme rico cogemeeeeee y empezó a meter y sacar tremenda verga sentía mi culito súper abierto dame duro rompe el culito rómpemelo rico te gusta cómo me la trago toda si señora coge divino ojala que me deje volver a estar con usted claro esta vergota vale la pena seguir comiéndomela y me ensartaba toda su vergota cada vez más rápido así aaaassssiiii que rico dámela toda mmmmmm mas dame mas toda la quiero tener toda adentro coges rico miguel yo movía como loca mi culito hacia todos lados y luego en círculos el gemía de placer y se empezó a venir ssssiiiiii échame tus mocos lléname mi culito de leche échamelos que rico siento cuando caen tus mocos calientitos vente rico aaaaaagggggghhhhhhh ya me estas sacando otro orgasmo me vengooooooo que rico pocas veces me vengo cuando me cogen por el culito y tu ya lo lograste que rico se siente termino de echar mocos y le dije que me la metiera toda y me la dejara así lo hizo y se la empecé a succionar con mi perrito aaaahhhhhh que rico siento señora me lo aprieta muy rico yyyyyaaaa me está haciendo venir se puso muy eufórico que hasta me saco el vestido que tenia enrolladlo en la cintura que rico señora aaaahhhhhh me vengoooo yo seguía mordiéndoselo hasta que me echo todos sus mocos y nos zafamos te gusto si mucho nunca había sentido lo que me hizo me senté y él me miraba mis tetas que ricas tetas tiene te gustas si están ricas me deja chupárselas claro hazme lo que quieras te lo ganaste hoy soy tu puta me las agarro y las empezó a chupar rico se separo y me dice con todo respeto me deja poner mi verga en medio de sus tetas claro acércate se levanto y puso su vergota entre mis tetas yo las apreté con mis manos y lo empecé a masturbar así subía y bajaba mis tetas y le chupaba la cabezota cuando subía que rico señora se siente rico y otra vez me echo mas mocos salpicándome la cara y las tetas así vente rico échamelos lo veo y no lo creo cuantos mocos has echado pues es que usted me pone así de caliente señora termino de venirse y se sentó voltio y vio que nos estaban viendo varios de sus amigos cosa que yo había notada todo el tiempo que cogimos se acomodo la ropa y me dice que iba a bajar que en un rato regresaba y se fue yo me quede recordando y sorprendida de cuantos mocos le saque y me di unos jalones casi me metí dos gramos y me puse en mi panochita y mi culito y de pronto se me vino a la mente presiento que va a pedirme que me coja a sus amigos y me dije pues si los trae me los cojo total ya estoy aquí y además me siento súper prendida y si después de un rato regreso con uno de sus amigos me lo presento yo seguía encueradita y su amigo no dejaba de mirarme diciéndome que hermosa esta señora yo sonreí y les dije que se subieran se subió el amigo y miguel me dice la dejo tantito con él y se retiro me empezó a manosear rico se saco la verga y pensé que era mi noche de suerte que vergotas se la agarre y la acariaba el me besaban por todo el cuerpo me jalo y me monto en sus piernas y me clavo toda su vergota aaaahhhhhh que rico así métemela toda me encanta la verga cógeme rico que rico métela toda ttttooooddddaaaa cójanme rico me encanta sentir la verga me encantaaaa que delicia cógeme rico métela toda mmmmmm que rico dame duro así que sabroso me tenía bien ensartada y me sentía cada vez más caliente cógeme mas fuerte quiero sentir el rigor de tu vergota así mas quiero masssssss sentí caer los chorros de mocos en mi panochita que rico vente rico échamelos todos aaaagggggghhhhhh me estoy viniendo que riccccooooo rrriiiiiccccooooo aaaahhhhhh sigue cogiéndome más quiero massssss terminamos de venirnos y nos zafamos gracias señora coge rico vi que le encanta mamarla y lo ha de hacer rico pues no te quedes con la duda y me empine a chupársela esmerándome para que supiera lo que es una buena mamada logrando hacerlo que se viniera me separo y me los echo en la cara y las tetas me baño de mocos echo muchísimos se me escurrían de la cara a las tetas que rico siento empecé a recogerlos con la mano y me los trague mmmmmm que ricos están me trague muchísimos se acomodo la ropa y se bajo dejándome encuerada y toda embarrada de mocos yo me los unte en mis tetas y cara sentía rico se me olvido que estaba encuerada y me estaban viendo me saque los mocos de mi culito y mi panochita y me los embarre en la cara y tetas me gusto lo que sentí me di otros jalones de coca acabándome otros dos gramos y me unte mas en mi panochita y mi culito me encanta lo que siento al echármela termine la cerveza y me metí mas coca me sentía eufórica me serví una cuba y en eso se acerco otro chavito y me dice disculpe le gustaría darme unas mamadas la vi cogiendo y me puso súper caliente sonreí y le dije que se subiera lo hizo y le digo pero si estás bien chavito cuántos años tienes 15 pues te la voy a mamar nada más para quitarte la tentación pero siento que todavía ni te crece bien le estaba diciendo y él se estaba sacando su verga del pantalón y al verlo que bárbaro tenía una tremenda verga pensé no cabe duda es mi noche de suerte y me empine a chupársela estaba más tremendo que miguel que rica vergota te cargas chamaco mmmmmm la devora encantada con tremenda vegota le estuve dando mis mejores chupadas hasta que lo hice venir yaaaaa señora me voy a venir si vente échamelos me los quiero tragar y sentí el primer chorro que llego hasta la garganta de lo fuerte que los aventó y más me lleno la boca de mocos me los trague y me volvía a llenar la boca mmmmmm que rico échamelos que ricos están mmmmmm fácil me lleno la boca cuatro veces que vigor de chamaco termino de echar y me levante lo vi a los ojos y le digo te gusto si lo mama rico pues ahora me la vas a tener que meter ya me pusiste cachonda me gire hacia él y levante las piernas las puse sobre sus hombros y le dije métemela y no lo pensó me la dejo ir toda aaaaasssssiiiiiii que rico que deliciosa vergota tienes chavo métemela toda así la siento chocar en el fondo me prendió y me zafe y me puse de rodillas en el asiento y le pedí que me la metiera por el culito métemela quiero sentir tu vergota en mi culito se acomodo y me dejo ir toda mmmmmm a que rico métela todaaaaaa que vergota tienes cógeme rico dámela toda siento que me floreas el culo pero sigue cogiéndome yo movía mi culito para todos lados y en círculos disfrutando tremenda vergota así aaaassssiiii métela todaaaaaa que rica vergota tienes chamaco cógeme duro y me daba tremendas ensartadas sentía chocar sus huevos en mis nalgas así aaaassssiiii cógeme que rico rrriiicccccooooooo dámela todaaaaaa aaaaaggggghhhh ya me sacaste mi lechita aaaahhhhhh que rico vente échame tus mocos échamelos así aaaassssiiii que rico siento caer tus mocos calientitos en mi culito mmmmmm que delicia terminamos se guardo la vergota y se bajo dándome las gracias me metí mas coca y termine mi copa me puse mi vestido y me pase adelante y me retire del lugar satisfecha de haber logrado mi objetivo y recordando las vergotas y las cogidas tan ricas que me dieron esto iba a poner a mí a mi esposo cuando se lo platique llegue a casa y dormí profundamente.

Otros relatos eroticos Fantasias

Una semana antes de su cumple mi esposo me pregunto ¿Qué me vas a regalar? prometiste que me darias lo que yo quisiera, yo pense que me diria que tuvieramos sexo anal mas seguido,yo racionaba mucho ese tipo de sexo ya que mi esposo tiene una verga muy gruesa y cada que tenemos sexo anal lo disfruto mucho si pero me queda el culo muy adolorido, el se vuelve loco con mi culito dice que esta muuy apretadito, pero no fue eso lo que el pidió, lo que queria era un capricho mas lujurioso,de plano me dijo -Quiero que invites a mi comadre Lina a tener sexo con nosotros, no me extraño que me pidiera hacer un trio ya que ese antojo ya lo había pedido de hace tiempo lo que si me saco de onda fue que me pidiera que invitaramos a Lina, ella ha sido mi amiga desde que eramos niñas
Relato erótico enviado por Aly el 15 de December de 2010 a las 01:16:59 - Relato porno leído 130940 veces
el acompañar a mi esposo a hacer unas compras en una ferreteria me encontre a un joven atrevido quien me recargo su vergota en las nalgas y me agrado terminando cogiendo riquisimo tenia una vergota como de burro mmmm que rica
Relato erótico enviado por comando bigos el 16 de March de 2013 a las 00:00:03 - Relato porno leído 116640 veces
SOMOS UNA PAREJA QUE DESDE MI MARIDO SE ENTERO QUE LE METI LOS CUERNO, LO UNICO QUE QUERIA ERA VERME HACIENDOLO DELANTE DE EL, VESTIDA COMO UNA PUTA..........
Relato erótico enviado por Anonymous el 25 de March de 2011 a las 00:11:50 - Relato porno leído 110569 veces

mi vecinita marisol culona

Categoria: Fantasias
DETRAS DE MI CASA VIVE UNA NINA MUY LINDA Y ES QUE LO QUE MAS ME ENCANTA ES SU CULO.
Relato erótico enviado por Anonymous el 04 de April de 2010 a las 16:35:57 - Relato porno leído 96613 veces
Hola, me llamo pablo, tengo 20 años, soy de argentina.
Hace muchisimo tiempo fantaseaba con la idea de que mi novia, eva, desate toda la furia sexual que seguramente llevaba dentro.
Ella era una mujer hermosa, pero un poco conservadora en la cama.

Relato erótico enviado por pervertido el 29 de August de 2004 a las 23:28:14 - Relato porno leído 69516 veces

Publica en tu muro de Facebook si te ha gustado el relato 'COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA:'
Si te ha gustado COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA: vótalo y deja tus comentarios ya que esto anima a los escritores a seguir publicando sus obras.

Por eso dedica 30 segundos a valorar COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA:. comando bigos te lo agradecerá.


Comentarios enviados para este relato
gatofeo (21 de April de 2014 a las 07:09) dice: hola mamacita he leido tus relatos y me haz puesto tan caliente que me la he jalado solo imaguinandote lo rica que estas me gustaria ver ese culo y esas tetas en una foto para llenarlas de mis mecos calientitos soy de la frontera de tamaulipas si eres de aqui cerca me gustaria conoserte para comerte todita te dejo mi correo elperico325 del hot te estare esperando mamacita


Registrate y se el primero en realizar un comentario sobre el relato COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA:.
Vota el relato el relato "COMPROBAR QUE LOS CHAPARROS ESTAN VERGUDOS TÉRMINO EN TREMENDA COGIDA:" o agrégalo a tus favoritos
Votos del Relato

Puntuación Promedio: 0
votos: 0

No puedes votar porque no estás registrado

Online porn video at mobile phone


el chavo del 8 xxx cap 6esposo pajero relatos eroticosRelatos xxx la joven esposa embarazada de chantajistami cu0Š9ada la violan los perros relato xxxrelato erotico de chantaje 100% realrelato campesina viuda y el pollon del yernovideos pornos maestras ispean alos alunno en el bañorelatos eroticos el viejo cogelonmujercitas l una yegua joven amedio domar relatosRelatos eroticos follando primita de 6 años dormidaFotos de vaginas peludas de cholitas empleadas domesticas de boliviarelatos eroticos esposa consentidas trio www nvideos.comel chavo del 8 xxx relato capitulo 1relatos eroticos entre primod primerisosconfesiones y relatos sexuales deperuanasRelatoseroticoshijosrelatos una imvitasion jefes sexoRelatos eroticos nietas_ NalgonasReltos porno cn gemidoslas colegialase arrechan relatosrelatos eroticos le llenan el biscocho de leche a mi esposadespedida de soltera follsdanegras sexo ana gordas primera vez relatosrelatos de novatocornudo xxxpornorelato masturandomeeliterelatos chiquillaxxx pillado oliendo bragas relatosgritaba llename la concha de lechewww.sexorelatos mi esposa ue una cojelonarelatos de mujeres que les gusta que le rebiente el culo durole pedi ami esposa borracha que se dejara cojer por mis amigosrelato un sadico viejo le ronpio la cola a mi hermanaRELATOS PORNO Argentina: Siiii yo soy tu putaaa asíii cogemeeefoto de espiando a mi cuñada x un agujerito Relatos si mijo metemelarelato erotico sere aplastado por esa gordapendejitas con pelitos en su chochocu 0Å 9adas con.elsobrinorelatos mi madre atada calzando sandaliasrelatos pornos de mujeres casadas infieles con pendejos en argentinacache:BnAU_DxZeaUJ:eqdo.ru/relatos-eroticos/infidelidades/90 videos xxx mi esposa infiel llega con las tetas marcadad de chupetonesA mi prima le esta saliendo vello pubico relatos pornorelatos vile a mi hija con vestidito de licraWww.relatoviolada.por.comSiii cogéme el culo, cogéme el culo que es tuyo,relatos eroticos recien casada y me entregue en una orgiaperverti mi esposa cuentos xxxfollando kn mi ku0Š9ada bucador de relatos eroticos disfrutando con mi vecino y mi maridomamme las tetas y cometelas papi xxx pornonadando juntos desnudos relatoRelatos de mi esposa se exhibe en el barconconfesandome con el sacerdote relatos calientesfeminizando y prostituyendo a mi cornudover porno me vistieron de nenita y me follaron duro (gay)relatos eroticos jovencitas con viejos gordos y feosVideo porn le cojiero duro a una mujer casada xq su esposo n la cojer a ella relato infielrelatos d jovenes desvirgados por la porterarelato erotico mi mujer se dejo cojer de un llanerorelatos eroticis de perdi mi virginidadestaba en la finca y con el caballo hice pornorelatos xxx recordando viejos tiemposme cogi a una vaca buscador de relatoseliterelatos lali y yoconfesiones del padre arturoVer hueco del culos como hacer para dilatar y entre un pepinorelatos eroticos cuidado que quede embarazadasister relatos pornorelato xxx en conquista de mi suegracoito interrumpidorelatos porno de foot slaveRelatos cachondos la esposa de mi primo me agarro la verga por una apuestarelato porno follar a mi jefa de recursos humsnosfollada sin compasion relatorelato erotico del chavo del ocho cap 6x favor quiero tu cola madurasrelatosmi prima me estrenorelatos cholas desfloradalo mejores relatos pornos de vecinitas huérfanasRelato Me coji a una puta de un barrelatos eroticos 2 compañeras de clasesrelatos de defloracinonrelatos eroticos mi esposo me mando con nuestro chofer solosrelatos eroticos sexy con el peon se la fincarelatos eróticos de dildos de descargas eléctricas relatos eroticos una procesión de semana santarelato mi hermanita menor es mi putita y la comparto con mis hermanossuegra en pollera agachada en la cocina para q la coja yerno